Post has published by Henri Dubret
  • Participant
    Posts893
    Member since: 24 février 2015

    Chapitre 4 deuxième partie : Une autre collaboration

    Quelque part dans le ciel au milieu de la France, à bord d’un bombardier R.A.F., 16 février 1941, 00h18 :

    -Nous sommes au dessus de Vichy, lieutenant !
    -Bien ! Continuez au nord-est, nous atteindrons…
    -L’Anaire ! C’est un petit ruisseau, nous vous parachuterons entre lui et Creuzier-le-Neuf, comme prévu !
    -Merci commandant !
    Qulques secondes plus tard, un bruit assourdissant se fait entendre.
    -Qu’est-ce-que c’est ?
    -Un moteur !
    TACTACTACTACTACTACTACTACTACTACTACTAC
    -Apparemment pas un ami !
    -Une vieille connaissance du moins : un Messermitch 301 ! J’ai fait sa connaissance en 40 pendant la bataille d’Angleterre ! Ils sont un peu capricieux !
    -C’est à dire ?
    -Pas très contrôlables et imprévisibles !
    -Pour leurs pilotes ?
    -Non, pour nous ! Ils se vexent facilement !
    -Ah !
    BOUM !
    -Touché ! Encore un pruneau pour ta choucroute, Franz !
    Quelques minutes plus tard, le combat est fini et le Messermitch allemand va s’écraser à terre.

    https://upload.wikimedia.org/wikipedia/commons/1/1e/Messerschmitt_Me_109G-6_of_JG_301_at_RAF_Manston_1944.jpg

    -Vous pouvez sauter, lieutenant ! Good luck !
    -Merci commandant !
    -Après, une descente qui lui parut interminable ( il n’était pas très habitué au saut en parachute ), le lieutenant Chervet toucha en fin la terre de France.
    -Ca fait du bien !
    -Halte ! Qui va là !
    Il n’avait pas eu le temps de retirer son parachute. Il dit la première partie du mot de passe convenu :
    -Pourquoi le maréchal est mort ?
    -Que pensez-vous de Darlan ?
    -Robert Chervet, lieutenant aux Forces Françaises Libres, 3e régiment d’infanterie de marine. “Nice to meet you” comme disent les anglais
    -Général Juin. J’ai tenu à venir à vos devants. Venez. Je vais vous conduire dans une ferme, chez des patriotes. Vous rencontrerez l’amiral Auphan demain
    -Entendu.
    Ils marchèrent une à deux minutes avant d’atteindre une petite chaumière.
    -Un sergent viendra vous chercher demain à 9 heures. Soyez près.
    -Bien mon général.
    -Bonne nuit lieutenant.
    -Bonne nuit mon général.
    Le lendemain, il rencontra l’amiral Auphan dans le salon d’un hôtel.

    http://ecole.nav.traditions.free.fr/celebres/auphan_jda.jpg

    -C’est le général De Gaulle qui vous envoie ?
    -Oui.
    -Bon. L’amiral Darlan n’aime ni les anglais, ni les allemands. Seulement, ces derniers se font de plus en plus pressants vis-à-vis de certaines lois, notamment antisémites. Hitler exige qu’on lui remette des aérodromes et la libre circulation sur le territoire. Nous avons fait la sourde oreille, nous refusons poliment, nous négocions etc. Enfin, un jour viendra où il faudra mettre tout cela en pratique. Vous devrez sur cela pour convaincre Darlan. Il connaît bien les avantages et les inconvénients qu’il y aurait à s’allier à l’Angleterre. Vous n’aurez qu’à le lui rappeller.
    La discution continua avec un certain nombre de conseils, questions etc.
    -Vous rencontrerez l’amiral demain à 14 heures.
    Le lieutenant prépara soigneusement sa plaidoirie. Il était fin près. Le lendemain , Juin et Auphan le firent pénétrer dans le cabinet de l’amiral Darlan.

    http://1.bp.blogspot.com/-aqIYVsLweB0/UNZfqMiblLI/AAAAAAAAE0g/SWyv1DxSnvc/s1600/U456708ACME.jpg

    La discution commença. Le lieutenant n’était pas à son aise mais il n’en laissa rien paraître. Finalement, l’amiral lui dit :
    -Lieutenant, suite à nos réticences Hitler envisage d’envahir le pays. Voici le plan d’invasion. L’Angleterre est elle prête pour nous envoyer des hommes, des obus et du matériel si nous n’en avons pas assez ? Sans quoi, je serai obligé de faire voter les lois antisémites et autres pour sauver le pays.
    -Certainement pas comme vous l’espérez. Faites voter les lois qu’impose l’Allemagne dans un mois. Faites-les mettre en pratique pour dans quatre mois. Commencez des arrestations, mais laissez des prisonniers s’évader. Dans cinq à six mois, l’Angleterre, la France libre et sans doute les Etats-Unis seront en mesure de vous soutenir. Relancer l’industrialisation et la construction militaire en masse, secrètement. Nous vous expédierons du matériel si besoin. Collaborer est déshonorant.
    -Vive la France ! ajouta Juin.
    -Je collaborerai ! rétorqua Darlan.
    Silence de mort.
    -Avec l’Angleterre, messieurs !
    FIN DU QUATRIEME CHAPITRE

  • A password will be emailed to you.